Make scientific figures in minutes

Create publication-quality figures with pre-made icons and templates, all from BioRender's web-based software

search icon

Try a synonym, or sign up to request an icon from the app.

Telomere

Telomere - Editable icon of Telomere
[]
Keywords
DNA (2D, squiggle 3),DNA (2D, squiggle 2),DNA replication (2D, fork),TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG,AATCCCAATCCCAATCCC,3',5',Chromosome (with telomeres 1)
Image types

Telomere icon JPEG

Telomere icon PNG

Telomere icon SVG

Telomere icon GIF

Join 1,500,000 other scientists on BioRender

Sign up for your free account and start creating scientific figures faster today
SIGN UP FREE
Decorative Chat Icon

FAQ

What is BioRender?
BioRender is a web‑based software that helps you create scientific figures in minutes. Use this Telomere icon along with our library of more than 30,000 life science icons.
Can I use this icon in a BioRender figure or scientific illustration?
Yes, the Telomere is fully integrated into BioRender’s drag-and-drop platform. You can easily add it to any scientific figure, workflow, or poster, whether you’re building from scratch or starting with a BioRender template.
Is the Telomere icon customizable in BioRender?
Most icons in BioRender, including the Telomere icon, are customizable. You can adjust icon size, colors, and positioning, and add custom labels to tailor the design to your specific research context.
How are scientists using the Telomere icon in their work?
BioRender users often use the Telomere icon in posters, grant applications, educational materials, and graphical abstracts. It’s especially useful for projects involving Nucleic Acids.
Can I export figures that include the Telomere icon for publication or presentations?
Yes, figures containing the Telomere icon can be exported in multiple formats, including PNG, JPG, PDF, and SVG. High-resolution and vector exports are available on paid plans, making them ideal for journals, slide decks, and print materials.
Is the Telomere icon used in BioRender templates or poster layouts?
Many BioRender templates include icons like the Telomere icon — especially those focused on Nucleic Acids. You can search BioRender’s template library or add this icon manually to any canvas.

Looking for science content?

Browse 50K+ icons and templates that are peer-reviewed, easy to use, and free.

Find yours now